Работа с текстом
<<  Назначение, классификация и возможности систем обработки текстов ABBYY TestReader 5.2 Новое в версии 5.2  >>
Распознавание регуляторных сигналов
Распознавание регуляторных сигналов
Транскрипция и трансляция в прокариотах
Транскрипция и трансляция в прокариотах
Эукариоты
Эукариоты
Сплайсинг ( эукариоты )
Сплайсинг ( эукариоты )
Транскрипция в прокариотах : Инициация транскрипции
Транскрипция в прокариотах : Инициация транскрипции
Транскрипция в прокариотах : Регуляция транскрипции
Транскрипция в прокариотах : Регуляция транскрипции
Структура ДНК-связывающего домена CI, фаг l
Структура ДНК-связывающего домена CI, фаг l
Структура ДНК-связывающего домена Cro, фаг l
Структура ДНК-связывающего домена Cro, фаг l
Белок-ДНКовые взаимодействия
Белок-ДНКовые взаимодействия
Регуляция транскрипции у эукариот
Регуляция транскрипции у эукариот
Регуляторные модули ( В. Ю. Макеев )
Регуляторные модули ( В. Ю. Макеев )
Представление сигналов
Представление сигналов
Консенсус
Консенсус
Образец
Образец
Матрица частот
Матрица частот
Диаграмма Лого ( Logo )
Диаграмма Лого ( Logo )
Позиционная весовая матрица (профиль )
Позиционная весовая матрица (профиль )
Позиционная весовая матрица (профиль )
Позиционная весовая матрица (профиль )
 
 
Составление выборки
Составление выборки
Перевыравнивание
Перевыравнивание
Начала генов Bacillus subtilis
Начала генов Bacillus subtilis
Распознавание регуляторных сигналов
Распознавание регуляторных сигналов
Распознавание регуляторных сигналов
Распознавание регуляторных сигналов
Позиционное информационное содержание до и после перевыравнивания
Позиционное информационное содержание до и после перевыравнивания
Оптимизация Expectation - Maximization
Оптимизация Expectation - Maximization
Оптимизация Expectation - Maximization
Оптимизация Expectation - Maximization
http://meme
http://meme
Оптимизация Expectation - Maximization
Оптимизация Expectation - Maximization
Имитация теплового отжига
Имитация теплового отжига
Имитация теплового отжига Алгоритм
Имитация теплового отжига Алгоритм
Gibbs sampler
Gibbs sampler
Использование свойств сигнала
Использование свойств сигнала
Распознавание сайтов :
Распознавание сайтов :
S = 21,2
S = 21,2
Распределение весов сайтов связывания рибосом
Распределение весов сайтов связывания рибосом
Оценка качества алгоритмов
Оценка качества алгоритмов
Промоторы Escherichia coli K-12
Промоторы Escherichia coli K-12
Эукариотические промоторы
Эукариотические промоторы
Сайты связывания рибосом
Сайты связывания рибосом
CRP (Escherichia coli)
CRP (Escherichia coli)
Запись GenBank для гена aroP E. coli
Запись GenBank для гена aroP E. coli
Что же делать
Что же делать
Консервативная область
Консервативная область
Менее консервативная область
Менее консервативная область
Rbsd в энтеробактериях
Rbsd в энтеробактериях
Сложная ситуация
Сложная ситуация
Сложная ситуация
Сложная ситуация
?
?
http://genome
http://genome
rVista
rVista
rVista
rVista
rVista
rVista
rVista
rVista
Распознавание регуляторных сигналов
Распознавание регуляторных сигналов

Презентация на тему: «Распознавание регуляторных сигналов». Автор: dimara. Файл: «Распознавание регуляторных сигналов.ppt». Размер zip-архива: 3608 КБ.

Распознавание регуляторных сигналов

содержание презентации «Распознавание регуляторных сигналов.ppt»
СлайдТекст
1 Распознавание регуляторных сигналов

Распознавание регуляторных сигналов

Д. А. Равчеев, М. С. Гельфанд В. Ю. Макеев (некоторые слайды)

Факультет биоинженерии и биоинформатики МГУ 2-й курс (набор 2007 года) Осенний семестр 2008

2 Транскрипция и трансляция в прокариотах

Транскрипция и трансляция в прокариотах

3 Эукариоты

Эукариоты

Прокариоты

1. Сопряжение транскрипции и трансляции 2. Котранскрипция нескольких генов (опероны)

Транскрипция Процессинг пре-мРНК Экспорт мРНК Трансляция

(синтез пре-мРНК)

Кэпирование сплайсинг полиаденилирование

4 Сплайсинг ( эукариоты )

Сплайсинг ( эукариоты )

Сборка сплайсосомы

Разрез на 5’ конце интрона, образование «аркана»

Разрез на 3’ конце интрона, соединение экзонов

5 Транскрипция в прокариотах : Инициация транскрипции

Транскрипция в прокариотах : Инициация транскрипции

Направление транскрипции

Промотор

Старт транскрипции

6 Транскрипция в прокариотах : Регуляция транскрипции

Транскрипция в прокариотах : Регуляция транскрипции

Активация

Репрессия

7 Структура ДНК-связывающего домена CI, фаг l

Структура ДНК-связывающего домена CI, фаг l

8 Структура ДНК-связывающего домена Cro, фаг l

Структура ДНК-связывающего домена Cro, фаг l

9 Белок-ДНКовые взаимодействия

Белок-ДНКовые взаимодействия

CI Cro

10 Регуляция транскрипции у эукариот

Регуляция транскрипции у эукариот

11 Регуляторные модули ( В. Ю. Макеев )

Регуляторные модули ( В. Ю. Макеев )

Регуляция транскрипции у эукариот

Один и тот же ген может регулироваться несколькими регуляторными модулями, работающими в разных условиях Расстояние от регуляторного модуля до кодирующих областей может достигать 100 000 пар оснований

12 Представление сигналов

Представление сигналов

Консенсус Pattern (“образец” - консенсус с вырoжденными позициями) Матрица частот, nucleotide frequency matrix Позиционная весовая матрица (или профиль) positional weight matrix, PWM, profile Логические правила РНКовые сигналы – вторичная структура

13 Консенсус

Консенсус

Сайты связывания PurR E. coli

cvpA purM purT purL purE purC purB purH purA1 purA2 guaB purR1 purR2 consensus

CCTACGCAAACGTTTTCTTTTT GTCTCGCAAACGTTTGCTTTCC CACACGCAAACGTTTTCGTTTA TCCACGCAAACGGTTTCGTCAG GCCACGCAACCGTTTTCCTTGC GATACGCAAACGTGTGCGTCTG CCGACGCAATCGGTTACCTTGA GTTGCGCAAACGTTTTCGTTAC TTGAGGAAAACGATTGGCTGAA TTTAAGCAAACGGTGATTTTGA TAGATGCAATCGGTTACGCTCT TAAAGGCAAACGTTTACCTTGC AACGAGCAAACGTTTCCACTAC ACGAAAACGTTTTCGT

14 Образец

Образец

Сайты связывания PurR E. coli

cvpA purM purT purL purE purC purB purH purA1 purA2 guaB purR1 purR2 consensus pattern

CCTACGCAAACGTTTTCTTTTT GTCTCGCAAACGTTTGCTTTCC CACACGCAAACGTTTTCGTTTA TCCACGCAAACGGTTTCGTCAG GCCACGCAACCGTTTTCCTTGC GATACGCAAACGTGTGCGTCTG CCGACGCAATCGGTTACCTTGA GTTGCGCAAACGTTTTCGTTAC TTGAGGAAAACGATTGGCTGAA TTTAAGCAAACGGTGATTTTGA TAGATGCAATCGGTTACGCTCT TAAAGGCAAACGTTTACCTTGC AACGAGCAAACGTTTCCACTAC ACGAAAACGTTTTCGT amGAAAaCGkTTwCwT

15 Матрица частот

Матрица частот

I = ?j ?b f (b, j) [log f (b, j) / p (b)]

Сайты связывания PurR E. coli

Информационное содержание :

F (b, j) – частота нуклеотида b в позиции j p (b) – частота нуклеотида в геноме

Где

16 Диаграмма Лого ( Logo )

Диаграмма Лого ( Logo )

I = ?j ?b f (b, j) [log f (b, j) / p (b)]

Сайты связывания PurR E. coli

17 Позиционная весовая матрица (профиль )

Позиционная весовая матрица (профиль )

W (b, j) = ln [N (b, j)+0,5] – 0,25 ?i ln [N (i, j)+0,5]

18 Позиционная весовая матрица (профиль )

Позиционная весовая матрица (профиль )

Термодинамическая мотивировка : свободная энергия

Предположение : независимость соседних позиций

19  

 

Сравнение частотной и весовой матриц

Частоты

Веса

20 Составление выборки

Составление выборки

Начало: Исправление ошибок Проверка литературных данных Удаление дубликатов

Genbank специализированные банки данных (ecocyc, regdb) литература (обзоры) литература (оригинальные статьи)

Предсказанные сайты

21 Перевыравнивание

Перевыравнивание

Первоначальное выравнивание по биологическим признакам Выделение сигнала в скользящем окне Перевыраванивание и т.д. пока не сойдётся

Промоторы : старт транскрипции участки связывания рибосом : стартовый кодон сайты сплайсинга : экзон-интронные границы

22 Начала генов Bacillus subtilis

Начала генов Bacillus subtilis

23 Распознавание регуляторных сигналов
24 Распознавание регуляторных сигналов
25 Позиционное информационное содержание до и после перевыравнивания

Позиционное информационное содержание до и после перевыравнивания

После

До

26 Оптимизация Expectation - Maximization

Оптимизация Expectation - Maximization

Породим начальное множество профилей (например, каждый из имеющихся k-меров породит один профиль)

K-мер : ACGT

Матрица (профиль) весов

Матрица частот

27 Оптимизация Expectation - Maximization

Оптимизация Expectation - Maximization

Для каждого профиля : Повторять пока не сойдётся

Найти наилучшего представителя в каждой последовательности обновить профиль

28 http://meme

http://meme

sdsc.edu/meme/meme.html

29 Оптимизация Expectation - Maximization

Оптимизация Expectation - Maximization

Недостатки метода :

Алгоритм сходится, но не может покинуть область локального максимума Поэтому если начальное приближение было плохим, он сойдётся к ерунде Решение: стохастическая оптимизация

30 Имитация теплового отжига

Имитация теплового отжига

I = ?j ?b f (b, j) [log f (b, j) / p (b)]

Цель : максимизировать информационное содержание I или любой другой функционал, измеряющий однородность множества сайтов

31 Имитация теплового отжига Алгоритм

Имитация теплового отжига Алгоритм

P = exp [ (I(B) – I(A)) / T ]

Температура T медленно снижается, первоначально она такова, что почти все изменения принимаются (Р ? 1).

A – текущий сигнал (множество потенциальных сайтов) I (A) – информационное содержание A

B – сигнал, отличающийся от А выбором сайта в одной последовательности I (B) – информационное содержание B

Если I (B) ? I (A), B принимается если I (B) < I (A), B принимается с вероятностью

32 Gibbs sampler

Gibbs sampler

P ~ exp [ (I (Anew) ]

A – текущий сигнал (множество потенциальных сайтов) I (A) – информационное содержание A

На каждом шаге в одной последовательности выбирается новый сайт с вероятностью

Для каждого потенциального сайта подсчитывается, сколько раз он был выбран.

33 Использование свойств сигнала

Использование свойств сигнала

ДНК-связывающие белки и их сигналы

РНК-сигналы

Кооперативные однородные

Кооперативные неоднородные

Другие

Палиндромы

Прямые повторы

Кассеты

34 Распознавание сайтов :

Распознавание сайтов :

W (b, j) = ln [N (b, j)+0,5] – 0,25 ?i ln [N (i, j)+0,5]

S (b1…bk) = ?i=1…k W (bi , j)

Весовые матрицы (профили)

Позиционные веса нуклеотидов

Вес потенциального сайта (k-мера) b1…bk – сумма соответствующих позиционных весов :

35 S = 21,2

S = 21,2

Распознавание сайтов : весовые матрицы (профили)

Вес данного потенциального сайта :

Escherichia coli K-12

carA

GCAATCTTCTTGCTGCGCAAGCGTTTTCCAGAACAGGTTAGATGATCTTTTTGTCGCT

36 Распределение весов сайтов связывания рибосом

Распределение весов сайтов связывания рибосом

Сайты

Не сайты

Кол-во сайтов

Вес

37 Оценка качества алгоритмов

Оценка качества алгоритмов

Трудно составить тестирующую выборку:

Правильно предсказанные

Чувствительность =

Все правильные

Правильно предсказанные

Специфичность =

Все предсказанные

Неизвестные сайты активация в определенных условиях неспецифическое связывание

38 Промоторы Escherichia coli K-12

Промоторы Escherichia coli K-12

Профиль предсказывает 1 сайт на 2000 нт

Чувствительность:

25% на всех промоторах 60% на конститутивных (неактивируемых) промоторах

39 Эукариотические промоторы

Эукариотические промоторы

Случайные предсказания

40 Сайты связывания рибосом

Сайты связывания рибосом

Надежность предсказания зависит от информационного содержания

Правильно предсказанные старты трансляции (в %)

Информационное содержание

41 CRP (Escherichia coli)

CRP (Escherichia coli)

OV = 1 – специфичность перепредсказание (% лишних среди всех предсказанных) UN = 1 – чувствительность недопредсказание (% потерянных правильных)

%

42 Запись GenBank для гена aroP E. coli

Запись GenBank для гена aroP E. coli

aroP

promoter

OxyR

ArgR

TyrR

TyrR

PutA

43 Что же делать

Что же делать

Выход :

Филогенетическое картирование (филогенетический футпринтинг) : “правильные” сайты консервативны

44 Консервативная область

Консервативная область

purL

PurR

45 Менее консервативная область

Менее консервативная область

yjcD

PurR

PurR

46 Rbsd в энтеробактериях

Rbsd в энтеробактериях

RbsR

47 Сложная ситуация

Сложная ситуация

Сайты консервативны …

Сайты связывания FruR перед ppsA

48 Сложная ситуация

Сложная ситуация

… Но не на выравнивании

49 ?

?

Метод проверки соответствия

Регулируется

НЕ регулируется

Базовый геном

Геномы родственных организмов

50 http://genome

http://genome

lbl.gov/vista/rvista/submit.shtml

51 rVista

rVista

Матрицы TRANSFAQ (частотные)

Или консенсус

52 rVista

rVista

all sites

aligned sites

conserved sites

CNS = conserved non-coding sequences

53 rVista

rVista

Conserved sites :

Aligned sites :

All sites :

Располагаются в участках последовательности, консервативность которых не менее 80% в окне 24 п.Н.

Ключевые позиции идентичны в обеих последовательностях

Все сайты : conserved+aligned+все остальные предсказанные

54 rVista

rVista

55 Распознавание регуляторных сигналов
«Распознавание регуляторных сигналов»
http://900igr.net/prezentacija/informatika/raspoznavanie-reguljatornykh-signalov-232044.html
cсылка на страницу

Работа с текстом

29 презентаций о работе с текстом
Урок

Информатика

130 тем
Слайды
900igr.net > Презентации по информатике > Работа с текстом > Распознавание регуляторных сигналов